Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 5134162
End position: 5134191
Length: 30

DNA sequence
>NC_008228, from 5134162 to 5134191 (30 bp); Pseudoalteromonas atlantica T6c GTCATTGTCATTGTCATTGTCATTGTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5133104-5134528	Sequence	Patl_4265 - Nidogen, extracellular region (Protein is coded in complementary strand; from 5134528 to 5133104)