Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3939337
End position: 3939366
Length: 30

DNA sequence
>NC_008228, from 3939337 to 3939366 (30 bp); Pseudoalteromonas atlantica T6c TGGCTCTGGCTCTGGCTCTGGCTCTGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3938993-3940138	Sequence	Patl_3280 - hypothetical protein (Protein is coded in complementary strand; from 3940138 to 3938993)