Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 1770155
End position: 1770181
Length: 27

DNA sequence
>NC_008228, from 1770155 to 1770181 (27 bp); Pseudoalteromonas atlantica T6c ATCACCTTGCTCACCTTGAGCACCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1768479-1770317	Sequence	Patl_1474 - hypothetical protein (Protein is coded in complementary strand; from 1770317 to 1768479)