Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 4351380
End position: 4351404
Length: 25

DNA sequence
>NC_008228, from 4351380 to 4351404 (25 bp); Pseudoalteromonas atlantica T6c TCAGTTCAGTTGAGTTCATTTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4350974-4352509	Sequence	Patl_3611 - phosphoglyceromutase (Protein is coded in complementary strand; from 4352509 to 4350974)