Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 1418545
End position: 1418569
Length: 25

DNA sequence
>NC_008228, from 1418545 to 1418569 (25 bp); Pseudoalteromonas atlantica T6c ATTGTATTGTTTTGTACTGTATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1418164-1419297	Sequence	Patl_1176 - hypothetical protein (Protein is coded in complementary strand; from 1419297 to 1418164)