Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 4092958
End position: 4092981
Length: 24

DNA sequence
>NC_008228, from 4092958 to 4092981 (24 bp); Pseudoalteromonas atlantica T6c ATTTATTCTTTTATTCATTTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4092224-4092976	Sequence	Patl_3416 - nucleotidyl transferase (Protein is coded in complementary strand; from 4092976 to 4092224)