Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3610580
End position: 3610603
Length: 24

DNA sequence
>NC_008228, from 3610580 to 3610603 (24 bp); Pseudoalteromonas atlantica T6c GGGGCGGAGGCGGAGGCGGAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3610168-3610782	Sequence	Patl_2986 - TonB family protein (Protein is coded in complementary strand; from 3610782 to 3610168)