Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 344799
End position: 344822
Length: 24

DNA sequence
>NC_008228, from 344799 to 344822 (24 bp); Pseudoalteromonas atlantica T6c TGGTCATGATCATCGTCATGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 343545-344942	Sequence	Patl_0294 - putative lipoprotein (Protein is coded in complementary strand; from 344942 to 343545)