Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 2380915
End position: 2380938
Length: 24

DNA sequence
>NC_008228, from 2380915 to 2380938 (24 bp); Pseudoalteromonas atlantica T6c TGCTTCTGTTTCTCCTTCTGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2379965-2381560	Sequence	Patl_1964 - tryptophan halogenase (Protein is coded in complementary strand; from 2381560 to 2379965)