Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 1807509
End position: 1807532
Length: 24

DNA sequence
>NC_008228, from 1807509 to 1807532 (24 bp); Pseudoalteromonas atlantica T6c TTGTTCTTGTTCTTGCTCTTGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1805833-1808088	Sequence	Patl_1503 - hypothetical protein (Protein is coded in complementary strand; from 1808088 to 1805833)