Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 1087810
End position: 1087833
Length: 24

DNA sequence
>NC_008228, from 1087810 to 1087833 (24 bp); Pseudoalteromonas atlantica T6c CTTCCACTTCCACTTCTACTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1087832-1088350	Sequence	Patl_0914 - hypothetical protein (Protein is coded in complementary strand; from 1088350 to 1087832)