Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1287820
End position: 1287891
Length: 72

DNA sequence
>NC_007951, from 1287820 to 1287891 (72 bp); Burkholderia xenovorans LB400 chromosome 1 CGATGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGT GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1285355-1289647	Sequence	Bxe_A3303 - DNA translocase FtsK (Protein is coded in complementary strand; from 1289647 to 1285355)