Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 127651
End position: 127722
Length: 72

DNA sequence
>NC_007951, from 127651 to 127722 (72 bp); Burkholderia xenovorans LB400 chromosome 1 CGCCGTCGGCGCCACCGCCACCGCCACCGCCACCGCCACCGCCACCGCCACCGCCACCGCCACCGCCACC GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 127509-128207	Sequence	Bxe_A4356 - carbon monoxide dehydrogenase, CoxG subunit (Protein is coded in complementary strand; from 128207 to 127509)