Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3500782
End position: 3500845
Length: 64

DNA sequence
>NC_007951, from 3500782 to 3500845 (64 bp); Burkholderia xenovorans LB400 chromosome 1 GGCGTTGAGGCGTTGAGGCGTTGAGGCGTTGAAGCGTTGAAGCGTTGAAGCGTTGAAGCGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3500708-3500926	Sequence	Bxe_A1289 - hypothetical protein (Protein is coded in complementary strand; from 3500926 to 3500708)