Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4301727
End position: 4301786
Length: 60

DNA sequence
>NC_007951, from 4301727 to 4301786 (60 bp); Burkholderia xenovorans LB400 chromosome 1 CCTTCTTCGCCGCAACCTTCTTCACCGCGACTTTCTTGGCTGCAACCTTCTTGGCCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4301351-4301968	Sequence	Bxe_A0525 - histone H1-like protein (Protein is coded in complementary strand; from 4301968 to 4301351)