Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1582326
End position: 1582379
Length: 54

DNA sequence
>NC_007951, from 1582326 to 1582379 (54 bp); Burkholderia xenovorans LB400 chromosome 1 CGCTCGTCACTCACGTCACTCACGTCACTCACGTCACTCACGTCACTCACCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1582378-1583121	Sequence	Bxe_A3012 - short-chain dehydrogenase (Protein is coded in complementary strand; from 1583121 to 1582378)