Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1473982
End position: 1474035
Length: 54

DNA sequence
>NC_007951, from 1473982 to 1474035 (54 bp); Burkholderia xenovorans LB400 chromosome 1 GGCAGCGCCAACGCCAACGCCAGCGCCAGCGCCAGCGCCAGCGCCAACGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1471985-1474195	Sequence	Bxe_A3132 - type III secretion hypersensitivity response secretion protein, HrcC/HrpA1- like