Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2656035
End position: 2656086
Length: 52

DNA sequence
>NC_007951, from 2656035 to 2656086 (52 bp); Burkholderia xenovorans LB400 chromosome 1 GCCCTTTTGCTTATCCCTTTTGCTTATCCCTTTTGCTTATCCCTTTTGCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2656085-2656348	Sequence	Bxe_A2059 - hypothetical protein (Protein is coded in complementary strand; from 2656348 to 2656085)