Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3500726
End position: 3500773
Length: 48

DNA sequence
>NC_007951, from 3500726 to 3500773 (48 bp); Burkholderia xenovorans LB400 chromosome 1 CGCGTTGACGCATTGACGCATTGACGCATTGACGCATTGACGCATTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3500424-3500747	Sequence	Bxe_A1290 - hypothetical protein (Protein is coded in complementary strand; from 3500747 to 3500424)
ORF. 3500708-3500926	Sequence	Bxe_A1289 - hypothetical protein (Protein is coded in complementary strand; from 3500926 to 3500708)