Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2171903
End position: 2171950
Length: 48

DNA sequence
>NC_007951, from 2171903 to 2171950 (48 bp); Burkholderia xenovorans LB400 chromosome 1 GCAGGAACCGAAGCAGGAACCGAAGCAGGAACCGAAGCAGGAACCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2171056-2172057	Sequence	Bxe_A2496 - TetR family transcriptional regulator