Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3694539
End position: 3694583
Length: 45

DNA sequence
>NC_007951, from 3694539 to 3694583 (45 bp); Burkholderia xenovorans LB400 chromosome 1 CCGGTTTGGCTTCGGCCACTTTGGCTTCGGCCGCTCTGGTTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3694388-3695674	Sequence	Bxe_A1085 - ribonuclease III (Protein is coded in complementary strand; from 3695674 to 3694388)