Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2198699
End position: 2198743
Length: 45

DNA sequence
>NC_007951, from 2198699 to 2198743 (45 bp); Burkholderia xenovorans LB400 chromosome 1 TACTTGGCTCGGCTCGGCTCGGCTCGGCTCGGCTCGGCTCGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2198540-2198899	Sequence	Bxe_A2465 - hypothetical protein (Protein is coded in complementary strand; from 2198899 to 2198540)