Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1819767
End position: 1819808
Length: 42

DNA sequence
>NC_007951, from 1819767 to 1819808 (42 bp); Burkholderia xenovorans LB400 chromosome 1 CGTGGCCGTTGAGCAGTGGCCGTCGAGCAGTGGCCGTCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1817878-1819779	Sequence	Bxe_A2823 - ribosomal large subunit pseudouridine synthase B