Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4186753
End position: 4186791
Length: 39

DNA sequence
>NC_007951, from 4186753 to 4186791 (39 bp); Burkholderia xenovorans LB400 chromosome 1 AGCGACGGCAACCCGCGACGGCAACCCGCGACGCCAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4185381-4186754	Sequence	Bxe_A0630 - (dimethylallyl)adenosine tRNA methylthiotransferase