Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4111973
End position: 4112008
Length: 36

DNA sequence
>NC_007951, from 4111973 to 4112008 (36 bp); Burkholderia xenovorans LB400 chromosome 1 TGCCTCACTTGCCTCACTTGCCTCACTTGCCTCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4112009-4113592	Sequence	Bxe_A0698 - D-alanyl-D-alanine carboxypeptidase PBP3