Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3372992
End position: 3373027
Length: 36

DNA sequence
>NC_007951, from 3372992 to 3373027 (36 bp); Burkholderia xenovorans LB400 chromosome 1 AGAATGCTCGTGGGGATGCTCGTGGGGATGCTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3372378-3373091	Sequence	Bxe_A1400 - hypothetical protein (Protein is coded in complementary strand; from 3373091 to 3372378)