Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3079471
End position: 3079506
Length: 36

DNA sequence
>NC_007951, from 3079471 to 3079506 (36 bp); Burkholderia xenovorans LB400 chromosome 1 GCGTGGATAACTGAGAGGATAACTGCGCGGATGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3078894-3080015	Sequence	Bxe_A1657 - hypothetical protein (Protein is coded in complementary strand; from 3080015 to 3078894)