Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2808931
End position: 2808966
Length: 36

DNA sequence
>NC_007951, from 2808931 to 2808966 (36 bp); Burkholderia xenovorans LB400 chromosome 1 CCCGCGTCGGCACCTGCGTCGGCACCCGCTTCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2808913-2809503	Sequence	Bxe_A1920 - tRNA-adenosine deaminase (Protein is coded in complementary strand; from 2809503 to 2808913)