Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1879199
End position: 1879234
Length: 36

DNA sequence
>NC_007951, from 1879199 to 1879234 (36 bp); Burkholderia xenovorans LB400 chromosome 1 CGCCGATGCCGATGCCGATGCCGATGCCGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1879122-1880009	Sequence	Bxe_A2773 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 1880009 to 1879122)