Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4574196
End position: 4574228
Length: 33

DNA sequence
>NC_007951, from 4574196 to 4574228 (33 bp); Burkholderia xenovorans LB400 chromosome 1 CCGCCTCAAACCAGCCTCAAACCAGCCTCAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4574224-4574976	Sequence	Bxe_A0267 - IclR family transcriptional regulator (Protein is coded in complementary strand; from 4574976 to 4574224)