Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4432495
End position: 4432527
Length: 33

DNA sequence
>NC_007951, from 4432495 to 4432527 (33 bp); Burkholderia xenovorans LB400 chromosome 1 CCGCTCAGTTGCCGCTCAGCCGTCGCTCAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4432522-4432917	Sequence	Bxe_A0406 hisE phosphoribosyl-ATP pyrophosphatase (Protein is coded in complementary strand; from 4432917 to 4432522)