Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3474142
End position: 3474174
Length: 33

DNA sequence
>NC_007951, from 3474142 to 3474174 (33 bp); Burkholderia xenovorans LB400 chromosome 1 TGCGCTCGGTCTGCGTTCGGTCTGCGCTCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3474170-3475684	Sequence	Bxe_A1313 - major facilitator transporter (Protein is coded in complementary strand; from 3475684 to 3474170)