Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2487051
End position: 2487082
Length: 32

DNA sequence
>NC_007951, from 2487051 to 2487082 (32 bp); Burkholderia xenovorans LB400 chromosome 1 AACGGGCTAATGGGCTAACGAGCTAACGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2486105-2487052	Sequence	Bxe_A2201 - AraC family transcriptional regulator