Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3510785
End position: 3510814
Length: 30

DNA sequence
>NC_007951, from 3510785 to 3510814 (30 bp); Burkholderia xenovorans LB400 chromosome 1 GCTTCAACCGGCTTCAACCCGCTTCAATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3510809-3512338	Sequence	Bxe_A1274 - Ppx/GppA phosphatase (Protein is coded in complementary strand; from 3512338 to 3510809)