Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1154612
End position: 1154641
Length: 30

DNA sequence
>NC_007951, from 1154612 to 1154641 (30 bp); Burkholderia xenovorans LB400 chromosome 1 GCGAGTTCAGGCGAGTTCAGGCGCGTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1154639-1155175	Sequence	Bxe_A3417 - TonB protein (Protein is coded in complementary strand; from 1155175 to 1154639)