Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4746646
End position: 4746672
Length: 27

DNA sequence
>NC_007951, from 4746646 to 4746672 (27 bp); Burkholderia xenovorans LB400 chromosome 1 CGGGTGCAACGGGCGCAACGGGTGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4745608-4746684	Sequence	Bxe_A0090 - nonspecific acid phosphatase precursor