Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4152242
End position: 4152268
Length: 27

DNA sequence
>NC_007951, from 4152242 to 4152268 (27 bp); Burkholderia xenovorans LB400 chromosome 1 GCCTGAGCCGCTTGAGCCGCTTGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4152108-4152416	Sequence	Bxe_A0662 - hypothetical protein (Protein is coded in complementary strand; from 4152416 to 4152108)