Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3248655
End position: 3248681
Length: 27

DNA sequence
>NC_007951, from 3248655 to 3248681 (27 bp); Burkholderia xenovorans LB400 chromosome 1 GCGGCGACTGCGGCGACTGCGGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3244664-3248950	Sequence	Bxe_A1513 - ATP-dependent helicase HrpA (Protein is coded in complementary strand; from 3248950 to 3244664)