Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3093656
End position: 3093682
Length: 27

DNA sequence
>NC_007951, from 3093656 to 3093682 (27 bp); Burkholderia xenovorans LB400 chromosome 1 TGCAGGTGATGCAGGTGATGCAGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3092749-3093750	Sequence	Bxe_A1644 - AraC family transcriptional regulator