Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2823401
End position: 2823427
Length: 27

DNA sequence
>NC_007951, from 2823401 to 2823427 (27 bp); Burkholderia xenovorans LB400 chromosome 1 CTGTTTGTCCTGTTTGCCCTCTTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2822928-2823533	Sequence	Bxe_A1905 - hypothetical protein (Protein is coded in complementary strand; from 2823533 to 2822928)