Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 18310
End position: 18336
Length: 27

DNA sequence
>NC_007951, from 18310 to 18336 (27 bp); Burkholderia xenovorans LB400 chromosome 1 AAGGCCACAAAGGCCGCAAAGGCCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 18021-18347	Sequence	Bxe_A4450 - hypothetical protein (Protein is coded in complementary strand; from 18347 to 18021)