Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2478805
End position: 2478829
Length: 25

DNA sequence
>NC_007951, from 2478805 to 2478829 (25 bp); Burkholderia xenovorans LB400 chromosome 1 AGTGGTGTGGCGTGGAGCGGAGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2477440-2478807	Sequence	Bxe_A2211 - major facilitator superfamily nitrate/nitrite transporter NarK/NasA