Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 975641
End position: 975664
Length: 24

DNA sequence
>NC_007951, from 975641 to 975664 (24 bp); Burkholderia xenovorans LB400 chromosome 1 CGATCAGGATCACGATGACGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 974518-975780	Sequence	Bxe_A3583 - major facilitator superfamily efflux pump membrane fusion protein (Protein is coded in complementary strand; from 975780 to 974518)