Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 4733206
End position: 4733229
Length: 24

DNA sequence
>NC_007951, from 4733206 to 4733229 (24 bp); Burkholderia xenovorans LB400 chromosome 1 CGCCGGCGTCGGCGCCGTGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4732887-4734404	Sequence	Bxe_A0102 - fliD; flagellar hook-associated protein