Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3912498
End position: 3912521
Length: 24

DNA sequence
>NC_007951, from 3912498 to 3912521 (24 bp); Burkholderia xenovorans LB400 chromosome 1 GGCGTCGGCGTCGGCGTCGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3911715-3912617	Sequence	Bxe_A0879 - hypothetical protein (Protein is coded in complementary strand; from 3912617 to 3911715)