Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 3300084
End position: 3300107
Length: 24

DNA sequence
>NC_007951, from 3300084 to 3300107 (24 bp); Burkholderia xenovorans LB400 chromosome 1 TCGCGCTCGCTCGCGCGCTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3299634-3300692	Sequence	Bxe_A1465 - ABC polyamine transporter, ATPase subunit