Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2923774
End position: 2923797
Length: 24

DNA sequence
>NC_007951, from 2923774 to 2923797 (24 bp); Burkholderia xenovorans LB400 chromosome 1 TTCGCCTACGCCTTCGCCTTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2921660-2924008	Sequence	Bxe_A1800 - ATP-dependent endonuclease (Protein is coded in complementary strand; from 2924008 to 2921660)