Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 2460681
End position: 2460704
Length: 24

DNA sequence
>NC_007951, from 2460681 to 2460704 (24 bp); Burkholderia xenovorans LB400 chromosome 1 CGTCCGCGTCCACGGCCGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2459354-2461528	Sequence	Bxe_A2223 - malate synthase G (Protein is coded in complementary strand; from 2461528 to 2459354)