Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1766640
End position: 1766663
Length: 24

DNA sequence
>NC_007951, from 1766640 to 1766663 (24 bp); Burkholderia xenovorans LB400 chromosome 1 GCGTCGGCGTCCGCATCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1764496-1766799	Sequence	Bxe_A2861 - small conductance mechanosensitive channel ion channel