Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1659987
End position: 1660010
Length: 24

DNA sequence
>NC_007951, from 1659987 to 1660010 (24 bp); Burkholderia xenovorans LB400 chromosome 1 GCGGCGGGGGCGGCGGAGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1659308-1660303	Sequence	Bxe_A2952 - hypothetical protein (Protein is coded in complementary strand; from 1660303 to 1659308)